Help improve this workflow!
This workflow has been published but could be further improved with some additional meta data:- Keyword(s) in categories input, output, operation, topic
You can help improve this workflow by suggesting the addition or removal of keywords, suggest changes and report issues, or request to become a maintainer of the Workflow .
A workflow for ChIP-seq analysis in Snakemake.
Table of Contents
Introduction
This workflow is a bioinformatics analysis pipeline for ChIP sequencing data. The workflow is built using Snakemake - a scalabale bioinformatics workflow engine
Requirements
This workflow requires the following software to run:
-
[Snakemake][snakemake]
-
[Conda][code]
Usage
Clone workflow into working directory:
git clone https://github.com/jma1991/chipseq.git
Execute workflow and deploy software dependencies via conda:
snakemake --use-conda
Configuration
Configure the workflow by editing the files in the
config
directory:
-
config.yamlis a YAML file containing the workflow metadata. -
samples.csvis a CSV file containing the sample metadata. -
units.csvis a CSV file contains the unit metadata.
Contributing
To contribute to the workflow, clone this repository locally and commit your code on a separate branch. Please generate unit tests for your code, and run the linter before opening a pull-request:
snakemake --generate-unit-tests # generate unit tests
snakemake --lint # run the linter
You can find more detail in our Contributing Guide . Participation in this open source project is subject to a Code of Conduct .
Thanks
I would like to thank Johannes Köster for developing the Snakemake workflow engine and Istvan Albert for writing the biostar handbook.
License
This workflow is licensed under the
MIT
license.
Copyright © 2020, James Ashmore
Code Snippets
8 9 | shell: "bowtie2 -x {params.idx} -U {input.fqz} -S {output.sam}" |
16 17 | shell: "samtools sort -o {output.bam} {input.sam}" |
24 25 | shell: "samtools merge {output.bam} {input.bam}" |
32 33 | shell: "samtools sort -n -o {output} {input}" |
40 41 | shell: "samtools fixmate -m {input} {output}" |
48 49 | shell: "samtools sort -o {output} {input}" |
56 57 | shell: "samtools markdup {input} {output}" |
64 65 | shell: "bioawk -t '$1 !~ /(M|_)/ {{print $1,0,$2}}' {input.fai} | gzip > {output.bed}" |
73 74 | shell: "samtools view -b -L {input.bed} -q 30 -F 3844 {input.bam} > {output.bam}" |
83 84 | shell: "bedtools intersect -v -g {input.fai} -sorted -a {input.bam} -b {input.bed}" |
91 92 | shell: "samtools sort -@ {threads} -n {input.bam} > {output.bam}" |
99 100 | shell: "samtools fixmate {input.bam} {output.bam}" |
107 108 | shell: "samtools sort {input.bam} > {output.bam}" |
115 116 | shell: "samtools view -b -f 2 {input.bam} > {output.bam}" |
6 7 | shell: "bamCoverage -b {input.bam} -o {output.wig} --normalizeUsing None --ignoreForNormalization chrX chrM --extendReads 146" |
14 15 | shell: "bamCoverage -b {input.bam} -o {output.wig} --normalizeUsing CPM --ignoreForNormalization chrX chrM --extendReads 146" |
23 24 | shell: "bigwigCompare -b1 {input.bw1} -b2 {input.bw2} --pseudoCount 0.01 --operation log2 -p {threads} -o {output.bw0}" |
32 33 | shell: "bigwigCompare -b1 {input.bw1} -b2 {input.bw2} --pseudoCount 0.01 --operation log2 -p {threads} -o {output.bw0}" |
41 42 | shell: "bigwigCompare -b1 {input.bw1} -b2 {input.bw2} --operation subtract -p {threads} -o {output.bw0}" |
6 7 | shell: "fasterq-dump -O {params.out} {wildcards.run}" |
14 15 | shell: "cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -o {output} {input}" |
Support
- Share:
-
-
-
- Future updates
Related Workflows
